View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_high_40 (Length: 262)
Name: NF19841_high_40
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 38568333 - 38568103
Alignment:
| Q |
18 |
gtttggacaccggacacaaatttaatgtgaagtgtctactacatagctttgaatttatttttctgaatgaaggtttcattttatgtttgaaaaaacaggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568333 |
gtttggacaccggacacaaatttaatgtgaagtgtctactacatagctttgaatttatttttctgaatgaaggtttcattttatgtttgaaaaaacaggt |
38568234 |
T |
|
| Q |
118 |
tgggaaatttctgcagctaatagcaacatttgttggcggttttgtgatagcatttagcagaggatggcttcttactgttgtattgatgtcaacacttcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568233 |
tgggaaatttctgcagctaatagcaacatttgttggcggttttgtgatagcatttaccagaggatggcttcttactgttgtattgatgtcaacacttcca |
38568134 |
T |
|
| Q |
218 |
cttcttgttgtgtcgggtgctgccatggctg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38568133 |
cttcttgttgtgtcgggtgctgccatggctg |
38568103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 85 - 248
Target Start/End: Complemental strand, 38527125 - 38526962
Alignment:
| Q |
85 |
tgaaggtttcattttatgtttgaaaaaacaggttgggaaatttctgcagctaatagcaacatttgttggcggttttgtgatagcatttagcagaggatgg |
184 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||| | ||| ||| |
|
|
| T |
38527125 |
tgaaggtttaattttgtgtttgaaaaaacaggttgggaagtttctgcagctaatagcaacatttattgggggttttgtgatagcatttacaaaagggtgg |
38527026 |
T |
|
| Q |
185 |
cttcttactgttgtattgatgtcaacacttccacttcttgttgtgtcgggtgctgccatggctg |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
38527025 |
cttcttactgttgttatgatgtcaacacttccatttcttgttgtgtcaggtgctgccatggctg |
38526962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University