View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19841_high_49 (Length: 236)

Name: NF19841_high_49
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19841_high_49
NF19841_high_49
[»] chr2 (1 HSPs)
chr2 (60-220)||(32782317-32782477)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 60 - 220
Target Start/End: Complemental strand, 32782477 - 32782317
Alignment:
60 acagatggacccattcaaatcccatatgattctactccttctcttctctcctccactgaagatccttctttcatacaaattgctgctagtgttctcctca 159  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||| |||||||||    
32782477 acagatggacccattgaaatcccatatgattctactccttctcttctctcttccactgacgacccttctttcatccaaatcgctgccagtcttctcctca 32782378  T
160 ctggtgctatctccgttctcctcttccgttccttccgccgtagagccaaacgtctcaaaca 220  Q
    | |||||||||||||| ||||||||||| ||||||||||| || || ||||||||||||||    
32782377 ccggtgctatctccgtcctcctcttccgctccttccgccgcagggctaaacgtctcaaaca 32782317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University