View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_high_50 (Length: 231)
Name: NF19841_high_50
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 43029409 - 43029208
Alignment:
| Q |
17 |
attactatggctgctgaaattagcaaaccaaatagggatagttacggttgatcttttcaatttcttgtgatccctaatggtttcagtttcatgatcagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029409 |
attactatggctgctgaaattagcaaaccaaatagggatagttacggttgatcttttcaatttcttgtgatccctaatggtttcagtttcatgatcagaa |
43029310 |
T |
|
| Q |
117 |
aatggattaaggatccatgttgaagtagcactgttttctaaaataggcaaatttggatataaagaagcatagtaagaacccattaatgatggattttcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029309 |
aatggattaaggatccatgttgaagtagcactgttttctaaaataggcaaatttggatataaagaagcatagtaagaacccattaatgatggattttcat |
43029210 |
T |
|
| Q |
217 |
ct |
218 |
Q |
| |
|
|| |
|
|
| T |
43029209 |
ct |
43029208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University