View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_high_54 (Length: 224)
Name: NF19841_high_54
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_high_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 23085558 - 23085751
Alignment:
| Q |
17 |
aatatttgaatacaatcttaaaaggaacacaaagggtgtgtttgataaaagtaagcca--taagttaacttatagctcataaactagttgataccgaaat |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
23085558 |
aatatttgaatacaatcataaaaggaacacaaagggtgtgtttgataaaagtaagccaaataaattaacttataactcataaactagttgatactgaaat |
23085657 |
T |
|
| Q |
115 |
tatattggtagtactaatactaattaatcactcgaaaaaacctgaagccgtagcttcgacaatggtagccataaaactagtaggatccattaaaac |
210 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23085658 |
tatattgctagtactaat--taattaatcactcgaaaaaacctgaagttgcggcttcgacaatggtagccataaaactagtaggatccattaaaac |
23085751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University