View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_low_30 (Length: 305)
Name: NF19841_low_30
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 4382681 - 4382986
Alignment:
| Q |
1 |
tgtgcagggagcttgtttcatccttctacttgtaaacccgtttgggtgaaagagacgagaatacgcttgcccataagtgttgaagttgaagtggtgtttg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382681 |
tgtgcggggagcttgtttcatccttctacttgtaaacctgtttcggtgaaagagacgagaatacgcttgcccataagtgttgaagttgaagtggtgtttg |
4382780 |
T |
|
| Q |
101 |
agaccttcataccggcgcctgtagggttttatacag-----------------gtgaagatcacgtgctgcggctgggaagaaggtgatgaagaaaagtt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4382781 |
agaccttcataccggcgcctgtagggttttatacagagatggtcaagtgtgaggtgaagatcacgtgctgcggctgggaagaaggtgatgaagagaagtt |
4382880 |
T |
|
| Q |
184 |
gtatatggatacaattgaatttacaatggatgatatgaatggagaacaattgacacggaaggatggtaacttaatcatctccaatgctattgaaaatggg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382881 |
ctatatggatacaattgaatttacaatggatgatatgaatggagaacaattgacacggaaggatggtaacttaatcatctccaatgctattgaaaatggg |
4382980 |
T |
|
| Q |
284 |
gagagg |
289 |
Q |
| |
|
|||||| |
|
|
| T |
4382981 |
gagagg |
4382986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 55
Target Start/End: Complemental strand, 4112594 - 4112546
Alignment:
| Q |
7 |
gggagcttgtttcatccttctacttgtaaacccgtttgggtgaaagaga |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
4112594 |
gggagcttgtttcatccttctacttgtaaacctgtttcggtgaaagaga |
4112546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 92 - 136
Target Start/End: Complemental strand, 4112515 - 4112468
Alignment:
| Q |
92 |
tggtgtttgagaccttcataccg---gcgcctgtagggttttatacag |
136 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
4112515 |
tggtgtttgagaccttcataccggcagcacctgtagggttttatacag |
4112468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University