View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_low_34 (Length: 285)
Name: NF19841_low_34
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 135 - 273
Target Start/End: Original strand, 15081927 - 15082065
Alignment:
| Q |
135 |
ttgttgaaaccataaatcataataacataccagttatatagaccattgaaattattgttattttcacaatattttaagatcatgctagttatagtataaa |
234 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15081927 |
ttgttgcaaccataaatcataataacataccagttatatagaccattgaaattattgttattttcacaatattttaagatcatgctagttatagtataaa |
15082026 |
T |
 |
| Q |
235 |
tttttcagtttcacatttctctcaactctctcacaggtt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15082027 |
tttttcagtttcacatttctctcaactctctcacgggtt |
15082065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 7 - 141
Target Start/End: Original strand, 15081767 - 15081903
Alignment:
| Q |
7 |
ttttttcttgttcatttctttcagttttctgatcactaccatggatactaaaaatatgaaagttgattgcataaccattaggaatt--tatcaatatgaa |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
15081767 |
ttttttcttgttcgtttctttcagttttctgatcactaccatggatactaaaaatatgaaagttgactgcataaccattaggaatttatatcaatatgaa |
15081866 |
T |
 |
| Q |
105 |
tatagttatttgatgtttgttaatttttgtttgttga |
141 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
15081867 |
tatagttatttgatgtttgttattttttgttttttga |
15081903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 69
Target Start/End: Original strand, 15081582 - 15081641
Alignment:
| Q |
10 |
tttcttgttcatttctttcagttttctgatcactaccatggatactaaaaatatgaaagt |
69 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| ||||| | ||||||||||||||| |
|
|
| T |
15081582 |
tttcttgtttatttctttcagttttctaatcactaacatggctgataaaaatatgaaagt |
15081641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University