View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_low_41 (Length: 261)
Name: NF19841_low_41
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 48251941 - 48252153
Alignment:
| Q |
18 |
tgccactcccttaaataacttaattttaattaatcgtaatggaatgtccttcattgtttctatcgtttatccctttttatgaaagaccttcattgtttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251941 |
tgccactcccttaaataacttaattttaattaatcgtaatggaatgtccttcattgtttctatcgtttatccctttttatgaaagaccttcattgtttat |
48252040 |
T |
 |
| Q |
118 |
tgaagttgcatgtgtttgtttgcaacttaatcggtactgctttttactttcaacggatgaaacgagttaaataaaactatattattaattgccgttattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48252041 |
tgaagttgcatgtgtttgtttgcaacttaatcggtactgctttttactttcaacggatgaaacgagttaaataaaactatattattaattgccgttattc |
48252140 |
T |
 |
| Q |
218 |
tagtttgcaagaa |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48252141 |
tagtttgcaagaa |
48252153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University