View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_low_49 (Length: 238)
Name: NF19841_low_49
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 60 - 221
Target Start/End: Complemental strand, 39322708 - 39322547
Alignment:
| Q |
60 |
tcattttaatcctaatcaagaataaaatgaaaattttagttatgttagaatagtgtttagtacaacttttaatcttttagagtaattcctcatttcttgt |
159 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39322708 |
tcattttaatcatattcaagaataaaatgaaaaatttagttatgttagaatagtctttggtacaacttttaatcttttagagtaattcctcatttcttgt |
39322609 |
T |
 |
| Q |
160 |
aggtaccaataaaatttgttcattacaaaatatgtgcaaaaatgcattaatcgatatattac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39322608 |
aggtaccaataaaatttgttcattacaaaatatgtgcaaaaatgcattaatccatatattac |
39322547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University