View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_low_50 (Length: 236)
Name: NF19841_low_50
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 60 - 220
Target Start/End: Complemental strand, 32782477 - 32782317
Alignment:
| Q |
60 |
acagatggacccattcaaatcccatatgattctactccttctcttctctcctccactgaagatccttctttcatacaaattgctgctagtgttctcctca |
159 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| || ||||||||||| ||||| ||||| ||| ||||||||| |
|
|
| T |
32782477 |
acagatggacccattgaaatcccatatgattctactccttctcttctctcttccactgacgacccttctttcatccaaatcgctgccagtcttctcctca |
32782378 |
T |
|
| Q |
160 |
ctggtgctatctccgttctcctcttccgttccttccgccgtagagccaaacgtctcaaaca |
220 |
Q |
| |
|
| |||||||||||||| ||||||||||| ||||||||||| || || |||||||||||||| |
|
|
| T |
32782377 |
ccggtgctatctccgtcctcctcttccgctccttccgccgcagggctaaacgtctcaaaca |
32782317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University