View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19842_high_15 (Length: 343)
Name: NF19842_high_15
Description: NF19842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19842_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 11 - 329
Target Start/End: Original strand, 41689266 - 41689584
Alignment:
| Q |
11 |
agaatattgcgagacgtagtgactgtgaagctaccaggttcaacacaggttaatgagttttcgaacaatggcttaaagggtaagaatagatcctgcagtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689266 |
agaatattgcgagacgtagtgactgtgaagctaccaggttcaacacgggttaatgagttttcgaacaatggcttaaagggtaagaatagatcctgcagtt |
41689365 |
T |
 |
| Q |
111 |
gttgagttcacatatattggaaacaagcaattgctggtggttcaagcttggttcagcggttgagattagggttttccatgatttggacgcacacataaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689366 |
gttgagttcacatatattggaaacaagcaattgttggtggttcaagcttggctcagcggttgagattagggttttccatgatttggacgcacacataaat |
41689465 |
T |
 |
| Q |
211 |
tgaaagagggaagtcaccggaagtctgaggaggatctcaaggatgagttcttccggcaagacaggcaatggcagtcgagtgctaacggtctccatttgaa |
310 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689466 |
tgaaagagggaagtcaccagaagtctgaggaggatctcaaggatgagttcttccggcaagacaggcaatggcagtcgagtgctaacggtctccatttgaa |
41689565 |
T |
 |
| Q |
311 |
gatcgtgattgagcttctt |
329 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41689566 |
gatcgtgattgagcttctt |
41689584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 171 - 283
Target Start/End: Original strand, 41682163 - 41682275
Alignment:
| Q |
171 |
tgagattagggttttccatgatttggacgcacacataaattgaaagagggaagtcaccggaagtctgaggaggatctcaaggatgagttcttccggcaag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41682163 |
tgagattagggttttccatgatttggacacgcacataaattgaaggagggaagtcactggaagtctgaggaggatctcaaggatgagttcttccggcaag |
41682262 |
T |
 |
| Q |
271 |
acaggcaatggca |
283 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41682263 |
acaggcaatggca |
41682275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 48 - 101
Target Start/End: Original strand, 41682029 - 41682083
Alignment:
| Q |
48 |
gttcaacacaggttaatgagttttcgaacaatggctt-aaagggtaagaatagat |
101 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41682029 |
gttcaacacgggtcaatgagttttcgaacaatggcttcaaagggtaagaatagat |
41682083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 269
Target Start/End: Original strand, 45096147 - 45096245
Alignment:
| Q |
171 |
tgagattagggttttccatgatttggacgcacacataaattgaaagagggaagtcaccggaagtctgaggaggatctcaaggatgagttcttccggcaa |
269 |
Q |
| |
|
||||| |||||||||||| | |||| || ||||| | |||||| ||| || |||||| ||||| ||||||||| || | |||||||||||||||||| |
|
|
| T |
45096147 |
tgagagtagggttttccaggttttgcacacacacttgtattgaaggagagatttcaccgaaagtcggaggaggatttccacgatgagttcttccggcaa |
45096245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 208 - 268
Target Start/End: Original strand, 44669426 - 44669486
Alignment:
| Q |
208 |
aattgaaagagggaagtcaccggaagtctgaggaggatctcaaggatgagttcttccggca |
268 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||| ||||||| ||||| ||||||||||| |
|
|
| T |
44669426 |
aattgaaggagggatctcaccggaagtcgaaggagtatctcaacgatgatttcttccggca |
44669486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 208 - 268
Target Start/End: Original strand, 44688702 - 44688762
Alignment:
| Q |
208 |
aattgaaagagggaagtcaccggaagtctgaggaggatctcaaggatgagttcttccggca |
268 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||| ||||||| ||||| ||||||||||| |
|
|
| T |
44688702 |
aattgaaggagggatctcaccggaagtcgaaggagtatctcaacgatgatttcttccggca |
44688762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 268
Target Start/End: Original strand, 44005483 - 44005579
Alignment:
| Q |
172 |
gagattagggttttccatgatttggacgcacacataaattgaaagagggaagtcaccggaagtctgaggaggatctcaaggatgagttcttccggca |
268 |
Q |
| |
|
||||||||||||||||| |||||| | | ||| || |||||| |||||| |||||||||| | | ||||| |||| ||||||||||||||||| |
|
|
| T |
44005483 |
gagattagggttttccaagatttgcaaacgcacttacattgaaggagggatctcaccggaagcttcaaaaggatatcaacgatgagttcttccggca |
44005579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University