View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19842_high_19 (Length: 314)
Name: NF19842_high_19
Description: NF19842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19842_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 5983168 - 5983481
Alignment:
| Q |
1 |
gcagagaagcacttgaacataagaatcacaaaatagattattttgtgtgtacaaacctgagaaaggataacatgagcaacaaatctctcaattaagagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5983168 |
gcagagaagcacttgaacataagaatcacaaaatagattattttgtgtgtacacacctgagaaaggataacatgagcaacaaatctctcaattaagag-t |
5983266 |
T |
 |
| Q |
101 |
tttaattcagcttcgattaattactgtacaagttttgaatcattataaatggc--ttttttattaaatacactactacattaaaatatttaca--tgtct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
5983267 |
tttaattcagcttcgattaattactgtacaagttttgaatcattataaatggcttttttttattaaatacac-gctacattaaaatatttacatctgtct |
5983365 |
T |
 |
| Q |
197 |
gaactatttgtgtctaaagtcttcttgtaaatgtatttgatgatgtgtat------------gatttcattcgattgttatttgctggcatgacattttc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5983366 |
gaactatttgtgtctaaagtcttcttgtaaatgtatttgatgatgtgtatgattttattcgagatttcattcgattgttatttgctggcatgacattttc |
5983465 |
T |
 |
| Q |
285 |
tcaaaggtgaaaaatg |
300 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5983466 |
tcaaaggtgaaaaatg |
5983481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University