View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19842_low_17 (Length: 326)
Name: NF19842_low_17
Description: NF19842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19842_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 15 - 317
Target Start/End: Complemental strand, 51822090 - 51821788
Alignment:
| Q |
15 |
agagatttctaaagcaacgtcgttggtatcaattgatcttagtaacaatcaaatttctgggaacattccagaaggtattggtcaacttcaacaacttggc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822090 |
agagatttctaaagcaacgtcgttggtatcaattgatcttagtaacaatcaaatttctgggaacattccagaaggtattggtcaacttcaacaacttggt |
51821991 |
T |
 |
| Q |
115 |
aacctgcatttgcagggtaacaagttaacaggggtaattccggagtctttaggttattgtaactcactcaacgacgttgatctttcgagaaatgaactct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821990 |
aacctgcatttgcagggtaacaagttaacaggggtaattccggagtctttaggttattgtaactcactcaacgacgttgatctttcgagaaatgaactct |
51821891 |
T |
 |
| Q |
215 |
cgaaagatattccttcttccttgggtttgttaccggctttaaattctctgaatttctcagagaatgaactttccggtaaaataccagagagtttaggttc |
314 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821890 |
cgaaagatattccttcgtccttgggtttgttaccggctttaaattctctgaatttctcagagaatgaactttccggtaaaataccagagagtttaggttc |
51821791 |
T |
 |
| Q |
315 |
att |
317 |
Q |
| |
|
||| |
|
|
| T |
51821790 |
att |
51821788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University