View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19842_low_9 (Length: 363)
Name: NF19842_low_9
Description: NF19842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19842_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 6e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 135 - 335
Target Start/End: Original strand, 9791386 - 9791584
Alignment:
| Q |
135 |
tattttgtcaaacaaaaccttgaatttatgtattgaaatagaaagaataggacaatattgtattgaactgcgcatatcactaaattaaaccttgtaaaag |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| | || |||||||||||||||||||| | || |
|
|
| T |
9791386 |
tattttgacaaacaaaaccttgaatttatgtattgaaatagaaagaaaagtacaatattgtattgaactacaca-atcactaaattaaaccttgt-atag |
9791483 |
T |
|
| Q |
235 |
attatcattaatggtatcaatatcatactgcatttagcaatagaaacgaacataannnnnnnnnnnnnaggtatgaaaggagccaaagatgcataataaa |
334 |
Q |
| |
|
| ||| | |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9791484 |
aatattagtaatggtatcaatatcattctgcatttagcaatagaaacgaacataatttttggttttttaggtatgaaaggagccaaagatgcataataaa |
9791583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University