View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19843_high_17 (Length: 226)
Name: NF19843_high_17
Description: NF19843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19843_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 37 - 208
Target Start/End: Original strand, 55100252 - 55100423
Alignment:
| Q |
37 |
cttaagtaatttttatgtgtaactgcggagaccgattctttaagatactaccaggtataatagcgacctctttcaatatataaatcaaacctttggatat |
136 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55100252 |
cttaagtaatttttatgtgcaactgcggagaccgattctttaagatactaccggttataatagcgacctctttcaatatataaatcaaacctttggatat |
55100351 |
T |
|
| Q |
137 |
tttcctcgaggcaaatagttgtaaggcttcgctcaagtggcattgttttggtgattttgatttgggactttg |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
55100352 |
tttcctcgaggtaaatagttgtaaggcttagctcaagtgacattgttttggtgatattgatttgggactttg |
55100423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University