View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19844_low_4 (Length: 374)
Name: NF19844_low_4
Description: NF19844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19844_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 76 - 248
Target Start/End: Original strand, 8315742 - 8315913
Alignment:
| Q |
76 |
tggggttaacacgttttttagataaaaatggcccaaattggnnnnnnnnnnnnnacaaaatgaatttggtaaaaacaaaagagtctcaagtttgaaccct |
175 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8315742 |
tggggttaacccgttttttagataaaaatggcccaaattggttttttagtttttacaaaatgaatttggcaaaaacaaaagagtctcaagtttgaaccct |
8315841 |
T |
 |
| Q |
176 |
gcggcgtcacagtctcaaattctgaacgagatatgaccgatcaggtattattgacttgtcaatcattctatag |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8315842 |
gcggcgtcacagtctcaaattctgaacgaga-atgaccgatcaggtattattgacttgtcaatcattctatag |
8315913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 8315654 - 8315687
Alignment:
| Q |
1 |
caatctggattagtaaatttggaggggtataatt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8315654 |
caatctggattagtaaatttggaggggtataatt |
8315687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University