View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19844_low_5 (Length: 368)
Name: NF19844_low_5
Description: NF19844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19844_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 33903342 - 33903154
Alignment:
| Q |
1 |
ttcaatactgtgttgtaaattcaaaccaccagggtaatgtggtatcttggttttcatatcaggccaaacgtttttcgccttttcatcgcctttccaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33903342 |
ttcaatactgtgttgtaaattcaaaccaccagggtaatgtggtatcttggttttcatatcaggccaaacgtttttcgtcttttcatcgcctttccaatct |
33903243 |
T |
 |
| Q |
101 |
aataacccgaaatgaaactcgggaggtagatcatacatgaaaactttcaaaacagcgttgcttttattgttattgctcttggtgtcgtt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903242 |
aataacccgaaatgaaactcgggaggtaaatcatacatgaaaactttcaaaacagcgttgcttttattgttattgctcttggtgtcgtt |
33903154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 254 - 352
Target Start/End: Complemental strand, 33903089 - 33902991
Alignment:
| Q |
254 |
acaaggattgctctattgctgaaggaggattcagagttttgtgattgagatgttaccaaatatgaaccgtcgttggaggtggtggaaagaagctgtgag |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903089 |
acaaggattgctctattgctgaaggaggattcagagttttgtgattgagatgttaccaaatctgaaccgtcgttggaggtggtggaaagaagctgtgag |
33902991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University