View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19844_low_7 (Length: 302)
Name: NF19844_low_7
Description: NF19844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19844_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 32124083 - 32124360
Alignment:
| Q |
1 |
tattcaccttacaaagttgaattctagtcactagactacttgactnnnnnnnnnnnnntatgacaatatctacgaagcattttaacgtaaatgactactt |
100 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32124083 |
tattcaccttacaatgttgaattcaagccactaggctacttgactaaaaaaataaaaatatgacaatatctacgaagcattttaacgtaaatgactactt |
32124182 |
T |
|
| Q |
101 |
tgaacataatgcacaattaaagactatcttaaaatattttaatatattgaatgactattatatgattactcgttatacatccaggaaccaaaatgatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | | ||||||| | ||||||||||||||| ||||||||||||| ||| |||||||| || |
|
|
| T |
32124183 |
tgaacataatgcacaattaaagactatcttaaaatattttgagacattgaattattattatatgattacttgttatacatccagaaactaaaatgattat |
32124282 |
T |
|
| Q |
201 |
taccaaaatagcgttgctaaatggcacgacatgtaatcccatgaatttgcatgactcggcttcttcacatgcaatttt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32124283 |
taccaaaatagcgttgctaaatggcacgacatgtaatcccatgaatttgcatgactcggcttcttcacatgcaatttt |
32124360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University