View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19845_low_11 (Length: 239)
Name: NF19845_low_11
Description: NF19845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19845_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 24314742 - 24314557
Alignment:
| Q |
19 |
gagcatgccaaggccctggcgaactccaaggtggcaactgcgaaggtggaaggtggtcgcattctggccaagggtagggaggagaaattgaaggagtcct |
118 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24314742 |
gagcatgccaaggccccggcaaactccaaggtagcaactgcgaaggtggaaggtggtcgcattctggccaagggtagggaggagaaattgaaggagtcct |
24314643 |
T |
|
| Q |
119 |
taatttgctgctgagaagctcagtatggaagacatgcaaatgcaaccatggtcttcttgaagaatactgctaaggaattgacttaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24314642 |
taatttgctgctgagaagctcagtatggaagacatgcaaatgcaaccatggtcttcttgaagaatactgctaaggaattgacttaa |
24314557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 24314544 - 24314508
Alignment:
| Q |
201 |
ttaagttatgattaatgacgctctttcgtctaatcaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24314544 |
ttaagttatgattaatgacgctctttcgtctaatcaa |
24314508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University