View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19847_high_3 (Length: 411)
Name: NF19847_high_3
Description: NF19847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19847_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 20 - 398
Target Start/End: Complemental strand, 42799490 - 42799112
Alignment:
| Q |
20 |
ttcctgtggtagacttgggttctggtacaattgataacatcatcacacaacccgccgtgattcatatgttggcagaatgtgctggacttcaatggttcga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42799490 |
ttcctgtggtagacttgggttctggtacaattgataacatcatcacacaacccgccgtgattcatatgttggcagaatgtgccggacttcaatggttcga |
42799391 |
T |
|
| Q |
120 |
aagttggggaaccaaggaactatctgatgttggtcttccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcatataagctctcattgcat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799390 |
aagttggggaaccaaggaactatctgatgttggtcttccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcatataagctctcattgcat |
42799291 |
T |
|
| Q |
220 |
tgaaccttgtcaagtatgaattctgcataactctagtgcatacagagtaaaatgctatcttgcatttcttaaatgtgtgtgcatatatggaaaatgcttc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799290 |
tgaaccttgtcaagtatgaattctgcataactctagtgcatacagagtaaaatgctatcttgcatttcttaaatgtgtgtgcatatatggaaaatgcttc |
42799191 |
T |
|
| Q |
320 |
aaaatagttatttcatttcccctttcaagtaaagcaagcttgtcgatcttgatgaacttgacaatggatcgtttcattc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799190 |
aaaatagttatttcatttcccctttcaagtaaagtaaacttgtcgatcttgatgaacttgacaatggatcgtttcattc |
42799112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University