View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19847_low_5 (Length: 375)

Name: NF19847_low_5
Description: NF19847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19847_low_5
NF19847_low_5
[»] chr7 (2 HSPs)
chr7 (211-357)||(5716026-5716180)
chr7 (25-79)||(5717153-5717207)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 211 - 357
Target Start/End: Complemental strand, 5716180 - 5716026
Alignment:
211 agtatgctactat-aaaaatagcttgtcataaaacttttt-atctactcaatttgttagtcaccacttgaagagtgggttaggatt------gatagttg 302  Q
    ||||||| ||||| |||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||      |||  |||    
5716180 agtatgcaactattaaaaatagtttgtcataaaacttttttatatactcaatttgttagtcaccacttgaagagtgggttaagatttgaatagattcttg 5716081  T
303 catatcagttaacagcaaacaaagtatggaaagttaattaccgagtaacatgaaa 357  Q
    ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
5716080 catatcagttaacagcaaacaaagtatggaaagataattactgagtaacatgaaa 5716026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 5717207 - 5717153
Alignment:
25 ataagcactacaaatatatagaaattgtaaccctcttttatttgtaaataatcta 79  Q
    ||||||| |||||||||||||||   |||||||| ||||||||||||||||||||    
5717207 ataagcagtacaaatatatagaacaagtaaccctgttttatttgtaaataatcta 5717153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University