View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19847_low_5 (Length: 375)
Name: NF19847_low_5
Description: NF19847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19847_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 211 - 357
Target Start/End: Complemental strand, 5716180 - 5716026
Alignment:
| Q |
211 |
agtatgctactat-aaaaatagcttgtcataaaacttttt-atctactcaatttgttagtcaccacttgaagagtgggttaggatt------gatagttg |
302 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||| ||| ||| |
|
|
| T |
5716180 |
agtatgcaactattaaaaatagtttgtcataaaacttttttatatactcaatttgttagtcaccacttgaagagtgggttaagatttgaatagattcttg |
5716081 |
T |
|
| Q |
303 |
catatcagttaacagcaaacaaagtatggaaagttaattaccgagtaacatgaaa |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
5716080 |
catatcagttaacagcaaacaaagtatggaaagataattactgagtaacatgaaa |
5716026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 5717207 - 5717153
Alignment:
| Q |
25 |
ataagcactacaaatatatagaaattgtaaccctcttttatttgtaaataatcta |
79 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
5717207 |
ataagcagtacaaatatatagaacaagtaaccctgttttatttgtaaataatcta |
5717153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University