View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19848_low_19 (Length: 310)
Name: NF19848_low_19
Description: NF19848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19848_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 152 - 295
Target Start/End: Complemental strand, 47107714 - 47107570
Alignment:
| Q |
152 |
gtgagtacattttagaatttttggctgtaatattaatcttaaattaagtctttttaacatgtatcatttcaacttattccagtaatagtgtcttacggct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47107714 |
gtgagtacattttagaatttttggctgtaatattaatcttaaattaaatctttttaacatgtatcatttcaacttattccagtaatagtgtcttacggct |
47107615 |
T |
 |
| Q |
252 |
tccttgat-ccccatctatgaaaaaactgcttcaagatatatggt |
295 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47107614 |
tccttgatcccccatctatgaaaaaactgcttcaagatatatggt |
47107570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 9 - 89
Target Start/End: Complemental strand, 47107857 - 47107777
Alignment:
| Q |
9 |
agatgaaggaaacatgcacaaagagacggtaaatattttcaaaacagtaaactgatatctcttgacagatcgaattccatg |
89 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47107857 |
agatgaaggaaacatgcacagagagacggtaaatattttcaaaacagtaaactgatatctcttgacagatcgaattccatg |
47107777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University