View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19848_low_27 (Length: 254)
Name: NF19848_low_27
Description: NF19848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19848_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 36504170 - 36503938
Alignment:
| Q |
13 |
ggtagaatattaaagtaagatatatcagaatgagcaaaaccatcttcactggtataagatgcacacccataagatattgtaaccatatatttgttcttga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36504170 |
ggtagaatattaaagtaagatatatcagaatgagcaaaaccatcttcactggtataagacgcacaaccataagatattgtaaccatatatttgttcttga |
36504071 |
T |
|
| Q |
113 |
atatggtgatggcttgttatatgaagaaaaaagctccataattttttccataaactgcgaaactgctttgaacttgaatatgatcagacagatgggtata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36504070 |
atatggtgatggcttgttatatgaagaaaaaagctccataattttttccataaactgcgaaactgctttgaacttgaatatgatcagacagatgggtata |
36503971 |
T |
|
| Q |
213 |
gcaaatgtaagagagattgtaagtttcctttgc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36503970 |
gcaaatgtaagagagattgtaagtttcctttgc |
36503938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University