View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19848_low_34 (Length: 242)
Name: NF19848_low_34
Description: NF19848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19848_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 32617755 - 32617544
Alignment:
| Q |
18 |
taatgctaatctttatatcactatatgaaattcaatttccactttgcaattatttataatgcaataccttttggtacaagaaagaaacttaattaattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32617755 |
taatgctaatctttatatcactatatgaaattcaatttccactttgcaattatttataatgcaataccttttgatacaagaaagaaacttaattaattaa |
32617656 |
T |
|
| Q |
118 |
actacattatgttatattatttacagaataatacttgatcaatgttttgccctgctggggatgaagttaacgtctgcgtcgttcttgtcagctgtgatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32617655 |
actacattatgttatattatttacagaataatacttgatcaatgttttgccctgctggggatgaagttaacgtctgcgtcgttcttgtcagctgtgatga |
32617556 |
T |
|
| Q |
218 |
actccgcgccct |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32617555 |
actccgcgccct |
32617544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University