View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19849_low_10 (Length: 236)
Name: NF19849_low_10
Description: NF19849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19849_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43028144 - 43027925
Alignment:
| Q |
1 |
ccaaccaaactcattaaaggttgtatttccaatgtaggcaaccctttatatcctcaagatcatctcactatttaacaatttcccctcacatacatcttca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
43028144 |
ccaaccaaactcattaaaggttgtagttccaatgcaggcaaccctttatatcctcaagatcatctcactatttaacaatttcccctcacataaattttca |
43028045 |
T |
|
| Q |
101 |
tcacccacctatctgttcttacttgaaaacataacatggctcacaatgatgttgaaactctcctcgcataccacagcatgactggtatttgaaacacctc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
43028044 |
tcacccacctatctgttcttacttg-aaacataacatggctcacaacgatgttgaaactctcctcgcataccgtagaatgactggtatttgaaacacctc |
43027946 |
T |
|
| Q |
201 |
catctttatacttatctttat |
221 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
43027945 |
catctttatactgatctttat |
43027925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 136 - 205
Target Start/End: Original strand, 34813658 - 34813727
Alignment:
| Q |
136 |
atggctcacaatgatgttgaaactctcctcgcataccacagcatgactggtatttgaaacacctccatct |
205 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
34813658 |
atggctcacaacaatgtttagactctcctcgcataccacaacatgactggtattaaaaacacctccatct |
34813727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 136 - 205
Target Start/End: Complemental strand, 24166718 - 24166649
Alignment:
| Q |
136 |
atggctcacaatgatgttgaaactctcctcgcataccacagcatgactggtatttgaaacacctccatct |
205 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
24166718 |
atggctcacaacaatgttcagactctcctcgcataccacaacatgactggtattaaaaacacctccatct |
24166649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University