View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1984_high_10 (Length: 258)

Name: NF1984_high_10
Description: NF1984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1984_high_10
NF1984_high_10
[»] chr1 (1 HSPs)
chr1 (1-216)||(5915496-5915711)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 5915496 - 5915711
Alignment:
1 gaaaatttacatattaaatacacgactctttttt-cttaatatatctgaaaaatgataaagagagacaaatgtattatataatatatgttttcatttttc 99  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |    
5915496 gaaaatttacagattaaatacacgactctttttttcttaatatatctgaaaaatgataaaaagagacaaatgtattatatgatatatgttttcatttt-c 5915594  T
100 ctcttttatcactttgggaccatatgggagggatagagtagtaaaacagcaatatggattgtggcaagcaaaaacaaaatcgagaaaattgtgttgagag 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5915595 ctcttttatcactttgggaccatatgggagggatagagtagtaaaacagcaatatggattgtggcaagcaaaaacaaaatcgagaaaattgtgttgagag 5915694  T
200 cagttgaggaggctcac 216  Q
    |||||||||||||||||    
5915695 cagttgaggaggctcac 5915711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University