View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1984_high_10 (Length: 258)
Name: NF1984_high_10
Description: NF1984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1984_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 5915496 - 5915711
Alignment:
| Q |
1 |
gaaaatttacatattaaatacacgactctttttt-cttaatatatctgaaaaatgataaagagagacaaatgtattatataatatatgttttcatttttc |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
5915496 |
gaaaatttacagattaaatacacgactctttttttcttaatatatctgaaaaatgataaaaagagacaaatgtattatatgatatatgttttcatttt-c |
5915594 |
T |
 |
| Q |
100 |
ctcttttatcactttgggaccatatgggagggatagagtagtaaaacagcaatatggattgtggcaagcaaaaacaaaatcgagaaaattgtgttgagag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5915595 |
ctcttttatcactttgggaccatatgggagggatagagtagtaaaacagcaatatggattgtggcaagcaaaaacaaaatcgagaaaattgtgttgagag |
5915694 |
T |
 |
| Q |
200 |
cagttgaggaggctcac |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5915695 |
cagttgaggaggctcac |
5915711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University