View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1984_high_9 (Length: 259)
Name: NF1984_high_9
Description: NF1984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1984_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 38569014 - 38568781
Alignment:
| Q |
10 |
attatactcgttaatgaatgatttctctttttgtcgtagtctagcgtggtaaatcagggagtgtcgtgtccgaacacctgcatatcaacatctttgcagc |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569014 |
attatattcgttaatgaatgatttctctttttgtcgtagtctagcgtggtaaatcggggagtgtcgtgtccgaacacctgcatatcaacatctttgcagc |
38568915 |
T |
 |
| Q |
110 |
tataccaaacgagctgtacttatgggatgaatgagatttttctttaatttgtagaataaattttcagttacnnnnnnnnnnnnnnnnntaaattaattac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38568914 |
tataccaaacgagctgtacttatgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatgatgattaaattaattac |
38568815 |
T |
 |
| Q |
210 |
aggtttctttgaaatatgtatatttggcagtagg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38568814 |
aggtttctttgaaatatgtatatttggcagtagg |
38568781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 243
Target Start/End: Complemental strand, 38527522 - 38527478
Alignment:
| Q |
199 |
aaattaattacaggtttctttgaaatatgtatatttggcagtagg |
243 |
Q |
| |
|
||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
38527522 |
aaattgattacaggtgtctttgaaatttgtatatttggcagtagg |
38527478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University