View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1984_low_14 (Length: 236)
Name: NF1984_low_14
Description: NF1984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1984_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 10506518 - 10506723
Alignment:
| Q |
13 |
aatatgtggtgaaactttgcaggaacaagaaatggttcaagatatggatatatccccaccggagtccccacaaaagaaacatcagtatgccaatatttct |
112 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
10506518 |
aatatgtagtgaaactttgcttgaacaagaaatggttcaagatatggatatatccccaccggagtccccacaaaagaa---tcagtatgacaatatttct |
10506614 |
T |
|
| Q |
113 |
aacagcaccaccctatttgctgctgcaccccagccccaaaggaatccttttaatgcttgctggtannnnnnnnnnnnagtctctacatatggtggtccta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
10506615 |
aacagcaccaccctatttgctgctgcaccccagccccaaaggaatccttttaatgcttgctggtaccccccagccccagtctcaacatatggtggtccta |
10506714 |
T |
|
| Q |
213 |
tgtttcatt |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
10506715 |
tgtttcatt |
10506723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University