View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1984_low_2 (Length: 344)
Name: NF1984_low_2
Description: NF1984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1984_low_2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 16 - 344
Target Start/End: Original strand, 14988873 - 14989201
Alignment:
| Q |
16 |
acatccgaatattgtgacgtagtttcgttcgtgtcagttgtcaccaaccccatttgaaaatggttttagatgtggttatttttattgttgtttggtctct |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14988873 |
acatccgaatattgtgacgtagtttcattcgtgtcagttgtcaccaaccccatttgaaaatggttttagatgtggttatttttattgttgtttggtctct |
14988972 |
T |
|
| Q |
116 |
tggaagccaacatattatcgatgaattccaatgagaaatggttttggttgttgtcggtgtcagggtagattcttgaaagctaataaaatgactagtctta |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14988973 |
tggaagccaacatattatcgatcaattccaatgagaaatggttttggttgttgtcggtgtcacggtagtttcttgaaagctaataaaatgactagtctta |
14989072 |
T |
|
| Q |
216 |
atggaaaagtcactcaaaggaccaagagtttctttgaatccaagttttgtaatgtttattgacaaagttacttgcaattgtagagtgttattttgcctta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14989073 |
atggaaaagtcactcaaaggaccaagagtttctttgaatccaagttttgtaatgcttattgacaaagttacttgcaattgtagagtgttattttgcctta |
14989172 |
T |
|
| Q |
316 |
aaggtatggcatgctcaactagctggagc |
344 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14989173 |
aaggtatggcatgctcaactagctggagc |
14989201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University