View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19850_high_6 (Length: 270)
Name: NF19850_high_6
Description: NF19850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19850_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 5 - 270
Target Start/End: Original strand, 2432040 - 2432305
Alignment:
| Q |
5 |
tgtccaagaaaataaaggggatttcgtgtcacttctccaaagatattccctcttttaaatctcccattgaatgatttattttgccttattctcaggcatg |
104 |
Q |
| |
|
||||||| ||| ||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2432040 |
tgtccaaaaaattaaaggggatttcccgtcacttctccaatgatattccgtcttttaaatctcccattgaatgatttattttgccttattctcaggcatg |
2432139 |
T |
 |
| Q |
105 |
ttgcttcacacgcaaagtactgctcttattactattagtatggacaaaacaaaacaaacattatcaattattatagggaatcataagaaaaaacatttca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2432140 |
ttgcttcacacgcaaagtactgctcttattactattagtatggacaaaacaaaacaaacattatcaattattatagggaatcacaagaaaaaacatttca |
2432239 |
T |
 |
| Q |
205 |
cataaaaggaaaagaagtaacaaacaactgtgtaaattatattataatttcattaaaaggataacc |
270 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2432240 |
cataaaaggaaaagaagcaacaaacaactgtgtaaattatattataatttcattaaaaggataacc |
2432305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 79 - 125
Target Start/End: Original strand, 44458019 - 44458065
Alignment:
| Q |
79 |
tttattttgccttattctcaggcatgttgcttcacacgcaaagtact |
125 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
44458019 |
tttattttggcttattcttaggcatgttgcttcacacgcaatgtact |
44458065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 79 - 125
Target Start/End: Original strand, 44465552 - 44465598
Alignment:
| Q |
79 |
tttattttgccttattctcaggcatgttgcttcacacgcaaagtact |
125 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
44465552 |
tttattttggcttattcttaggcatgttgcttcacacgcaatgtact |
44465598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University