View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19850_low_10 (Length: 211)
Name: NF19850_low_10
Description: NF19850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19850_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 133 - 206
Target Start/End: Original strand, 44591007 - 44591080
Alignment:
| Q |
133 |
cccgccacaaagttccgtggccattgaaattgtgactctgctactcaaccagattactgtatcttcatctcact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44591007 |
cccgccacaaagttccgtggccattgaaattgtgactctgctactcaaccagattactgtatcttcatttcact |
44591080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University