View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19850_low_6 (Length: 291)
Name: NF19850_low_6
Description: NF19850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19850_low_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 12 - 291
Target Start/End: Complemental strand, 33943860 - 33943576
Alignment:
| Q |
12 |
gaattggttcattttctttcgagttttagtaaatatcctctgagtggacaagaattcacaaatattctttcaaaactgagacttcacacttgattggtgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33943860 |
gaattggttcattttctttcgagttttagtaaatatcctctgagtggacaagaattcacaaatattctttcaaaactgagacttcacacttgattggtgg |
33943761 |
T |
 |
| Q |
112 |
taggagtgttaatatcatttcaannnnnnnaaacatgtcatctacatcaaaccaaaccgcgtataattttatatttggagatgatgttcttttttgcttt |
211 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33943760 |
taggagtgttaatatcatttcaatttttttaaacgtgtcatctacatcaaaccaaaccgcgtataattttatatttggagatgatgttcttttttgcttt |
33943661 |
T |
 |
| Q |
212 |
aaacacagttcaaaatgcacaacaaacacttctaattagtggc-----atatgatatgtttcaagatgggttttattgttcatga |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33943660 |
aaacacagttcaaaatgcacaacaaacacttctaattagtggcatataatatgatatgtttcaagatgggttttattgttcatga |
33943576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University