View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19851_high_17 (Length: 221)
Name: NF19851_high_17
Description: NF19851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19851_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 5337625 - 5337429
Alignment:
| Q |
8 |
tgtcgaagaatatcttcgtgtacttgcatatgagtatgctactatgggctctcttcatgacattttgcacggtatgtagcatcatatccattcttaaatt |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337625 |
tgtcgaagaaaatcttcgtgtacttgcatatgagtatgctattatgggctctcttcatgacattttgcacggtatgtagcatcatatccattcttaaatt |
5337526 |
T |
 |
| Q |
108 |
atacttcatataagaagttccgttgatgattttgatgtctttccattacaggtaaaaatggagttcaaggggcgcaaccatggccaactcttaattg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337525 |
atacttcatataagaagttccgttgatgattttgatgtctttccattacaggtaaaaatggagttcaaggggcgcaaccatggccaactcttaattg |
5337429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 52717414 - 52717596
Alignment:
| Q |
19 |
atcttcgtgtacttgcatatgagtatgctactatgggctctcttcatgacattttgcacggtatgtagcatcatatccattcttaaattatacttcatat |
118 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| | ||| | || |||| |
|
|
| T |
52717414 |
atctccgtgtacttgcatatgagtttgctactatgggctctcttcatgacattttgcacggtatgtagcttcatatcctttctttacttaaattttatat |
52717513 |
T |
 |
| Q |
119 |
aagaagttccgttgatgattttgatgtctttccattacaggtaaaaatggagttcaaggggcgcaaccatggccaactcttaa |
201 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||| ||| |||||||||||||| |||||| ||||||||||||| |
|
|
| T |
52717514 |
aagaagttccattgatgattttggcgactttccattacaggtagaaagggagttcaaggggcacaaccagggccaactcttaa |
52717596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University