View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19851_low_14 (Length: 242)
Name: NF19851_low_14
Description: NF19851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19851_low_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 49445646 - 49445870
Alignment:
| Q |
18 |
acatgtactaacagcttccagttatagttgagagagagaagcttcaagtgggccaaattatgaaagatgggaatcttttcatgagggcgatacatctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49445646 |
acatgtactaacagcttccagttatagttgagagagagaagcttcaagtgggccaaattatgaaagatgggaatctcgtcatgagggcgatacatctaaa |
49445745 |
T |
|
| Q |
118 |
caacaatgtagaaagacaaacactcagaaataagggaaaattatcaaaacaaggcataatcgaaaatacacaccaatcaggtttttcatctcctttcgat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49445746 |
caacaatgtagaaagacaaacactcagaaataagggaaaattaccaaaacaaggcataatcgaaaatacacaccaatcaggtttttcatctcctttcgat |
49445845 |
T |
|
| Q |
218 |
tagtgtttttacttagcaacatatt |
242 |
Q |
| |
|
|||||||||| | |||||||||||| |
|
|
| T |
49445846 |
tagtgtttttccgtagcaacatatt |
49445870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University