View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19851_low_4 (Length: 480)
Name: NF19851_low_4
Description: NF19851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19851_low_4 |
 |  |
|
| [»] scaffold1484 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 17 - 465
Target Start/End: Original strand, 5665297 - 5665744
Alignment:
| Q |
17 |
gggtcttttgagaggtttggtacaaaggagaggataaggggttatttttcgggagcagacggatatagctgcctaaagggagcaatagattgaggaggag |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665297 |
gggtcttttgagaggtttggtacaaagaagagggtaaggggttatttt-cgggagcagacagatatagctgcctaaagggagcaatagattgaggaggag |
5665395 |
T |
 |
| Q |
117 |
gactttgaccagggaaaggaggaggagttcgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665396 |
gactttgaccatggaaaggaggaggagtttgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttc |
5665495 |
T |
 |
| Q |
217 |
ttatcactaatgtagttgtttttattttcatgtagttgttctaaaaataatgtggccacttagtgttttgtaacatcgtgattcccttatccattgcact |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665496 |
ttatcactaatgtagttgtttttattttcatgtagttgttctaaaaataatgtggccacttagtgttttgtaacatcgtgattcccttatccattgcact |
5665595 |
T |
 |
| Q |
317 |
gcatatgcacttgtttgttattaatgagcttgctttttcttgaaatttatcagtctgataacaactatttcaccaattgtatttcgaaagttgaggcatg |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665596 |
gcatatgcacttgtttgttattaatgagcttgctttttcttgaaatttatcagtctgataacaactatttcaccaattgtatttcgaaagttgaggcatg |
5665695 |
T |
 |
| Q |
417 |
catgaatattcaacccaaatctttaaatggtcaagtgaagtgacggaag |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665696 |
catgaatattcaacccaaatctttaaatggtcaagtgaagtgacggaag |
5665744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1484 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1484
Description:
Target: scaffold1484; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 316 - 371
Target Start/End: Original strand, 171 - 226
Alignment:
| Q |
316 |
tgcatatgcacttgtttgttattaatgagcttgctttttcttgaaatttatcagtc |
371 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| ||||||| |||| ||||| |
|
|
| T |
171 |
tgcatatgcacttgtttattattaatgaatttgctttgtcttgaattttaccagtc |
226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University