View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19852_high_3 (Length: 365)
Name: NF19852_high_3
Description: NF19852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19852_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 5 - 286
Target Start/End: Complemental strand, 48286532 - 48286251
Alignment:
| Q |
5 |
gaaccgaggtggaattctggtatggaaggttgatagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286532 |
gaaccgaggtggaattctggtatggaaggttggtagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaa |
48286433 |
T |
|
| Q |
105 |
atgtgcaacaacataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggat |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286432 |
atgtgcaacaaaataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggat |
48286333 |
T |
|
| Q |
205 |
gtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286332 |
gtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
48286251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University