View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19852_high_6 (Length: 302)
Name: NF19852_high_6
Description: NF19852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19852_high_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 10 - 302
Target Start/End: Complemental strand, 2377545 - 2377253
Alignment:
| Q |
10 |
gagatgaagtttgaggttgagagagtggtgggtattggatgagtttggtgacgaaaaatagcgtgttgaaatgagtagatagatactggaagtgattatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2377545 |
gagatgaagtttgaggttgagagagtggtgggcattggatgagtttggtgacgaaaaatagcgtgttgaaatgagtagatagatactggaagtgattatg |
2377446 |
T |
|
| Q |
110 |
atggattgaatttgattccattgttttaggttttggtggttctttgaaagggatgcaattgcatttgcatagcattgcttggtgttgagaagggttaacg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
2377445 |
atggattgaatttgattccattgttttaggttttggtggttctttgaaagggatgcaattgcatttgcatagcattgtttggtgttgagatgggttaacg |
2377346 |
T |
|
| Q |
210 |
agaacaaaaatgaaattgaagtttggagttgagaagggttaatgagtttatttggagggatttgggataaaaggtttgattggagttcgtttt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2377345 |
agaacaaaaatgaaattgaagtttggagttgagaagggttaatgagtttatttggagggatttgggataaaaggtttgattggagttcgtttt |
2377253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 10 - 174
Target Start/End: Complemental strand, 28198476 - 28198317
Alignment:
| Q |
10 |
gagatgaagtttgaggttgagagagtggtgggtattggatgagtttggtgacgaaaaatagcgtgttgaaatgagtagatagatactggaagtgattatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |||||||| | |||| ||| | || ||||| | | ||| ||||| || |
|
|
| T |
28198476 |
gagatgaagtttgaggttgagagagtggtgcgcattggatgagtttggcgacgaaaa-tggcgtcttggagtgtgtagaga----ccggaggtgatgatc |
28198382 |
T |
|
| Q |
110 |
atggattgaatttgattccattgttttaggttttggtggttctttgaaagggatgcaattgcatt |
174 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28198381 |
gtggattgaatttgattccattgtttcaggttttgatggttctttgaaagggatgcaattgcatt |
28198317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 13325188 - 13325273
Alignment:
| Q |
212 |
aacaaaaatgaaattgaagttt-ggagttgagaagggttaatgagtttatttggagggatttgggataaaaggtttgattggagtt |
296 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||| ||||||| ||||||||| |||||||| |||||||| ||||| |
|
|
| T |
13325188 |
aacaaaaatgaaattgaaattttggagttgagagtggttaatggatttattttgagggattttggataaaaagtttgattagagtt |
13325273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University