View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19852_low_2 (Length: 236)
Name: NF19852_low_2
Description: NF19852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19852_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 28599833 - 28599943
Alignment:
| Q |
111 |
gttttagtttatggttataggtgccttgttaattgggtaactagattacaaaattgcgttaagatgtgacatatgcgaccttaattttagtcgaattgca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28599833 |
gttttagtttatggttataggtgccttgctaattgggcaactagattacaaaattgcgttaagatgtgacatatgtgaccttaattttagtcgaattgca |
28599932 |
T |
 |
| Q |
211 |
atcatagatac |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
28599933 |
atcatagatac |
28599943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University