View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19852_low_2 (Length: 236)

Name: NF19852_low_2
Description: NF19852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19852_low_2
NF19852_low_2
[»] chr5 (1 HSPs)
chr5 (111-221)||(28599833-28599943)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 28599833 - 28599943
Alignment:
111 gttttagtttatggttataggtgccttgttaattgggtaactagattacaaaattgcgttaagatgtgacatatgcgaccttaattttagtcgaattgca 210  Q
    |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
28599833 gttttagtttatggttataggtgccttgctaattgggcaactagattacaaaattgcgttaagatgtgacatatgtgaccttaattttagtcgaattgca 28599932  T
211 atcatagatac 221  Q
    |||||||||||    
28599933 atcatagatac 28599943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University