View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19854_high_4 (Length: 310)

Name: NF19854_high_4
Description: NF19854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19854_high_4
NF19854_high_4
[»] chr8 (1 HSPs)
chr8 (227-278)||(6085028-6085079)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 6085028 - 6085079
Alignment:
227 gactccccaccacatgtgtcacttgattcaatgaaactggatacctcttcat 278  Q
    ||||||||||||||||||||||||||||||||| ||||| ||||||| ||||    
6085028 gactccccaccacatgtgtcacttgattcaatgtaactgcatacctcctcat 6085079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University