View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19854_high_5 (Length: 297)
Name: NF19854_high_5
Description: NF19854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19854_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 4498661 - 4498925
Alignment:
| Q |
19 |
gaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcagcagggttttggggggtttgcattgctattttctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4498661 |
gaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttggatttgcagcagggttttggggggtttgcattgctactttctt |
4498760 |
T |
|
| Q |
119 |
tatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttgtctttatctgtcaagagggacgaaaatgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4498761 |
gatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttgtctttatctgtcaagagggatgaaaatgt |
4498860 |
T |
|
| Q |
219 |
gggaattggaccatcccgctgctaggagtctggtcgatattgaagttgtattgaagtctcgtatt |
283 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498861 |
gggaattggaccataccgccgctaggagtctggtcgatattgaagttgtattgaagtctcgtatt |
4498925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 4329248 - 4329074
Alignment:
| Q |
19 |
gaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcagcagggttttggggggtttgcattgctattttctt |
118 |
Q |
| |
|
||||||| ||||| |||||| | |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329248 |
gaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttggatttgcagcagggttttggggggtttgcattgctattttctt |
4329149 |
T |
|
| Q |
119 |
tatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttgtctt |
193 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4329148 |
taacagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgagacctttgtctt |
4329074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 197 - 283
Target Start/End: Complemental strand, 4329036 - 4328946
Alignment:
| Q |
197 |
ctgtcaagagggacgaaaatgtgggaattggaccatcccgctg----ctaggagtctggtcgatattgaagttgtattgaagtctcgtatt |
283 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
4329036 |
ctgtcaagagggatgaaaatgtggaaattggaccataccgcacgccactaggagtctggtcgatattgaagttgcattgaagtctcatatt |
4328946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University