View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19854_high_7 (Length: 235)
Name: NF19854_high_7
Description: NF19854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19854_high_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 270934 - 271168
Alignment:
| Q |
1 |
attgagaaattcggctccgatcccaaaaatcttcgtatggtgactgacagaccttctcggattgaggtaaacccaataaaggatcataatggataatgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
270934 |
attgagaaattcggctccgatcccaaaaatcttcgtatggtgactgacagaccttctcggattgaggtaaacccaataaaggatcataatggattatgac |
271033 |
T |
|
| Q |
101 |
taataatcattatatcctcacaaatacatggaataacttagtttaatggatnnnnnnntgtttttgtgaatatatcttatgtgtaaatattcacactagt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
271034 |
taataataattatatcctcacaaatacatggaataacttagtttaatggataacaaaatgtttttgtgaatatatcttatgtgtaaatattcacactagt |
271133 |
T |
|
| Q |
201 |
agttaattatttgtaaggaaatgttaaagagtacc |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
271134 |
agttaattatttgtaaggaaatattaaagagtacc |
271168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 69
Target Start/End: Original strand, 14910 - 14951
Alignment:
| Q |
28 |
aatcttcgtatggtgactgacagaccttctcggattgaggta |
69 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14910 |
aatctttgtatggtgactgatagaccttctcggatcgaggta |
14951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 69
Target Start/End: Complemental strand, 16384393 - 16384352
Alignment:
| Q |
28 |
aatcttcgtatggtgactgacagaccttctcggattgaggta |
69 |
Q |
| |
|
|||||| ||||||||||||| |||| |||||||||||||||| |
|
|
| T |
16384393 |
aatctttgtatggtgactgatagactttctcggattgaggta |
16384352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University