View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19855_low_17 (Length: 250)
Name: NF19855_low_17
Description: NF19855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19855_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 5355524 - 5355760
Alignment:
| Q |
1 |
cacaaatgttattatcataaaacaactagttataggtaaaagcacatgtgatttgaatcatattcacataaacagaaaatcagaatgacaaaacatttgt |
100 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| | |||| |
|
|
| T |
5355524 |
cacaaatgttattatgataaaaccactagttataggtaaaagcacatgtgattcgaatcatattcacataaacagaaaaccagaatgacaaaaaaattgt |
5355623 |
T |
|
| Q |
101 |
catgattggaatcactctcggttttaattcgaatcacaaccaccataaactccaaattattgattttaaggcacaatcatttacacgcacgtttacattt |
200 |
Q |
| |
|
|||||| | |||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5355624 |
catgatcgaaatcactctcggttttgattcaaatcacaaccaccataaactccaaattgttgattttaaggcacaatcatttacacatacgtttacattt |
5355723 |
T |
|
| Q |
201 |
gaacatcagcattatatattcgaatgcgtgggtattc |
237 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5355724 |
ggacatcagcattatatattcggatgcgtgggtattc |
5355760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University