View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_high_30 (Length: 259)
Name: NF19856_high_30
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 42631796 - 42631567
Alignment:
| Q |
19 |
atcttatccacccatgaaccgtaaaggaacttacatttcaatattctggagtattttcaacatgggtggtgttattggtgggttgattccttttattctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631796 |
atcttatccacccatgaaccgtaaaggaacttacatttcaattttctggagtattttcaacatgggtggtgttattggtgggttgattccttttattctt |
42631697 |
T |
|
| Q |
119 |
aattacaatcgtggtgatcaagctgctacggttaatgatggaacttatattggttttatggcttttatgtcactagggactgttttgtctctaactattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631696 |
aattacaatcgtggtgatcaagctgctacggttaatgatggaacttatattggttttatggcttttatgtcactagggactgttttgtctctaactattt |
42631597 |
T |
|
| Q |
219 |
taccagctagtaaagttgttcgtgatgatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42631596 |
taccagctagtaaagttgttcgtgatgatg |
42631567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 42638940 - 42638711
Alignment:
| Q |
19 |
atcttatccacccatgaaccgtaaaggaacttacatttcaatattctggagtattttcaacatgggtggtgttattggtgggttgattccttttattctt |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
42638940 |
atcttatccacccatgaatcgtaaaggaacttacatttcaattttctggagtattttcaatatgggtggggttattggtggtttaattccttttattctt |
42638841 |
T |
|
| Q |
119 |
aattacaatcgtggtgatcaagctgctacggttaatgatggaacttatattggttttatggcttttatgtcactagggactgttttgtctctaactattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
42638840 |
aattacaatcgtggtgatcaagctgctacggttaacgatggcacttatattggttttatggcttttatgtcactagggactgttttgtctctgacaattt |
42638741 |
T |
|
| Q |
219 |
taccagctagtaaagttgttcgtgatgatg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
42638740 |
taccagccagtaaagttgttcgtgatgatg |
42638711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University