View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_high_41 (Length: 230)
Name: NF19856_high_41
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 116 - 209
Target Start/End: Complemental strand, 40773878 - 40773783
Alignment:
| Q |
116 |
cctctcttgggtttgtaaatgagaataccttttgggaaggaaggaaacaaattaaggt--ggagaagagaatgcatatgtgccaagtttggggaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40773878 |
cctctcttgggtttgtaaatgagaataccttttgggaaggaaggaaacaaattaaggtgaggggaagagaatgcatatgtgccaagtttggggaca |
40773783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 40773979 - 40773941
Alignment:
| Q |
15 |
atagggaaagccatgggaaaataattattcatgagattg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40773979 |
atagggaaagccatgggaaaataattattcatgagattg |
40773941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University