View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_high_45 (Length: 222)
Name: NF19856_high_45
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 56 - 203
Target Start/End: Complemental strand, 33153284 - 33153137
Alignment:
| Q |
56 |
ctgctgtacatgtttcggttgaatagctgggtgattatctatgagctttaatgtgagaatgtttattgaggagggatgcagtttggagcaagtcattgca |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33153284 |
ctgctgtaaatgtttcggttgaatagctgggtgattatctctgagctttaatgtgagaatgtttattgaggagggatgcagtttggagcaagtcattgca |
33153185 |
T |
 |
| Q |
156 |
taatgttttctagtgttcatgattcagtttgataagtttcaaaggctg |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
33153184 |
taatgttttctagtgtttatgattcagtttgataagcttcaaaggctg |
33153137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 151
Target Start/End: Complemental strand, 33173416 - 33173373
Alignment:
| Q |
108 |
gtgagaatgtttattgaggagggatgcagtttggagcaagtcat |
151 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33173416 |
gtgagattgtttattgaggagggatgcagtttggtgcaagtcat |
33173373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University