View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_high_47 (Length: 209)
Name: NF19856_high_47
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_high_47 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 19206743 - 19206566
Alignment:
| Q |
15 |
aatacttaagtgaatgccattacctctgcatacatgcctatcattagctccttctaaatctaccaacatatattttcttttatcttctatgcaatacata |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19206743 |
aatacttaagtgaataccattacctctgcatacatgcctatcattagctccttctaaatctaccaacatatatattcttttatcttctatgcaatacata |
19206644 |
T |
|
| Q |
115 |
atttctacggagcagagtattgtggtgtattgcacgcttaccttcaccttgtctaggtacaattcaggcgcgattatct |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19206643 |
atttctacggagcagagtattgtggtgtattgc-cgcttaccttcaccttgtctaggtacaattcaggcgcgattatct |
19206566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 151 - 193
Target Start/End: Complemental strand, 9108 - 9066
Alignment:
| Q |
151 |
cttaccttcaccttgtctaggtacaattcaggcgcgattatct |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
9108 |
cttaccttcaccttgtctaggtacaactcaggcgcaattatct |
9066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 193
Target Start/End: Complemental strand, 25196190 - 25196148
Alignment:
| Q |
151 |
cttaccttcaccttgtctaggtacaattcaggcgcgattatct |
193 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
25196190 |
cttaccttcaccttgtctaggtataattcaggtgtgattatct |
25196148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University