View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_low_12 (Length: 373)
Name: NF19856_low_12
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 360; Significance: 0; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Original strand, 36998731 - 36999090
Alignment:
| Q |
1 |
tggctgacatctgatgtgccccagtgggatgtccataattcccagtggtagagtatgtggcggtccccgttccagtcgtccctgtggtgtggtggggctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998731 |
tggctgacatctgatgtgccccagtgggatgtccataattcccagtggtagagtatgtggcggtccccgttccagtcgtccctgtggtgtggtggggctg |
36998830 |
T |
 |
| Q |
101 |
acccatatgcccagccgcagcagtggtcgtctgtttgaccgccgcattgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998831 |
acccatatgcccagccgcagcagtggtcgtctgtttgaccgccgcattgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctct |
36998930 |
T |
 |
| Q |
201 |
ttcttatgggttgccatctctttttgcacaggatcacgtgctgtcatcttctcagtctggagataaattagttcaacacatgttaggaacaaacaacaca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998931 |
ttcttatgggttgccatctctttttgcacaggatcacgtgctgtcatcttctcagtctggagataaattagttcaacacatgttaggaacaaacaacaca |
36999030 |
T |
 |
| Q |
301 |
aatgtgacccataactagcacattgaaagaagaaaaaagagttcttcaaaagtatactat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36999031 |
aatgtgacccataactagcacattgaaagaagaaaaaagagttcttcaaaagtatactat |
36999090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 147 - 259
Target Start/End: Original strand, 36994070 - 36994182
Alignment:
| Q |
147 |
ttgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctctttcttatgggttgccatctctttttgcacaggatcacgtgctgtca |
246 |
Q |
| |
|
||||||||||| || ||| ||||| ||||| |||||||| | | || | |||||||| |||||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
36994070 |
ttgtgttcacgcgccgcctctttatcaagctcagcctggttaaccctttcttctttcttttgggttgccatctctttttgcaaaggatcatgtgccgtca |
36994169 |
T |
 |
| Q |
247 |
tcttctcagtctg |
259 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
36994170 |
tcttctctgtctg |
36994182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 259
Target Start/End: Original strand, 36988346 - 36988407
Alignment:
| Q |
198 |
tctttcttatgggttgccatctctttttgcacaggatcacgtgctgtcatcttctcagtctg |
259 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| ||||||| |||| ||||||||||| ||||| |
|
|
| T |
36988346 |
tctttcttttgggttgccatctccttttgcaaaggatcatgtgccgtcatcttctctgtctg |
36988407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University