View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_low_16 (Length: 358)
Name: NF19856_low_16
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 62 - 351
Target Start/End: Complemental strand, 22795194 - 22794898
Alignment:
| Q |
62 |
tgaagctttcattgtttgacaaacttttccttatgaacctgcagaagcatgta--tacaaattgctcatgacattgaatacgagcaaaaagaaaacacat |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | | |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22795194 |
tgaagctttcattgtttgacaaacttttccttatgaacctgcagaagaaaacacatacaaaatgctcatgacattgaatacgagcaaaaagaaaacacat |
22795095 |
T |
|
| Q |
160 |
at--tttttcaaactaaaaagacgagtagttggaagtaaaaatgcatacataccccatgaaagaacggcgacgcgagttgattttattttcaggggtctc |
257 |
Q |
| |
|
|| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22795094 |
atattttttcaaactaaaaagatgagtagttgtaagtaaaaatgcatacataccccatgaaagaacggcgacgcgagttgattttattttcaggggtctc |
22794995 |
T |
|
| Q |
258 |
agtgatgggatgcattgaattaaaatgagtatctcctc---ctccagaatgtgatttgcgtcgaaatgaaggcaaagtactctcggattttcttctc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22794994 |
agtgatgggatgcattgaattaaaatgagtatctcctcctcctccagaatgtgatttgcgtcgaaatgaaggcaaagtactctcggattttcttctc |
22794898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University