View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_low_34 (Length: 255)
Name: NF19856_low_34
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_low_34 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 74 - 255
Target Start/End: Complemental strand, 9462854 - 9462673
Alignment:
| Q |
74 |
tggattttcttttgctaagaagattattccccttgttaaggaaaatgcacgtccaatgaaagacatcaagaaagtaagttctactactaaatcatgcact |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462854 |
tggattttcttttgctaagaagattattccccttgttaaggaaaatgcacgtccaatgaaagacatcaagaaagtaagttctactactaaatcatgcact |
9462755 |
T |
|
| Q |
174 |
tcctaaatgctatatatgtagttaaagattatttcccttgttaaggaagctatgcaacattgacaccgaagacatatctatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9462754 |
tcctaaatgctatatatgtagttaaagattatttcccttgttaaggaagctatgcaacattgacaccgaagacatgtctatt |
9462673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 9462916 - 9462880
Alignment:
| Q |
12 |
gattattctgcagccaaagtcttggttgagtcaagtg |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462916 |
gattattctgcagccaaagtcttggttgagtcaagtg |
9462880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University