View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_low_42 (Length: 239)
Name: NF19856_low_42
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 118 - 221
Target Start/End: Original strand, 14937199 - 14937302
Alignment:
| Q |
118 |
catgaatcaattagcattaataatcattgttaattaaacattattagcaaaacgaaaacaaacaaaagttttttagatatgtgtatggaacaaattgtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14937199 |
catgaatcaattagcattaataatcattgttaattaaacattattagcaaaacgaaaacaaacaaaagttttttagatatgtgtattgaacaaattgtta |
14937298 |
T |
|
| Q |
218 |
attg |
221 |
Q |
| |
|
|||| |
|
|
| T |
14937299 |
attg |
14937302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 12 - 98
Target Start/End: Original strand, 14937085 - 14937171
Alignment:
| Q |
12 |
agaagaagaagagccaggaatgggacctttgatggggaaatacctgttcttctctgggtcaaagtaaaacccaggaagctctgtctc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14937085 |
agaagaagaagagccaggaatgggacctttgatggggaaatacctgttcttctctgggtcaaagtagaacccaggaagctctgtctc |
14937171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University