View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19856_low_43 (Length: 237)
Name: NF19856_low_43
Description: NF19856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19856_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 34353038 - 34353230
Alignment:
| Q |
19 |
gaaaatgcatgacagattctccaggattatctgacttggagacagtttcattctcgacggttctcatctcaacatctgcacatgtggtagtctcagttac |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353038 |
gaaaatgcgtgacagattctccaggattatctgacttggatacagtttcattctcgacagttctcatctcaacatctgcacatgtggtagtctcagttac |
34353137 |
T |
|
| Q |
119 |
catctcactcctttcttggatatcggcgcaagaaggcagggctgtcgccatttcagaagactttttggctgtctttcgtattttccttccatag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
34353138 |
catctcactcctttcttggatatcggcgctagaaggcaggggtgtcgccatttcagaagactttttggc-gtctttcatgttttccttccatag |
34353230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 179
Target Start/End: Complemental strand, 10376920 - 10376760
Alignment:
| Q |
19 |
gaaaatgcatgacagattctccaggattatctgacttggagacagtttcattctcgacggttctcatctcaacatctgcacatgtggtagtctcagttac |
118 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||| | |||||| ||| |
|
|
| T |
10376920 |
gaaattgcacgacagattctccaggatgatctgacttcattgtggtttcattctcgacggttctcatctcaacatctgcacgtgtcgctatctcaggtac |
10376821 |
T |
|
| Q |
119 |
catctcactcctttcttggatatcggcgcaagaaggcagggctgtcgccatttcagaagac |
179 |
Q |
| |
|
|||||||||||| |||||||| | ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
10376820 |
catctcactcctctcttggatgttggcgctagaaggcagggatgtcgccatttcagaagac |
10376760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University